Clear Search sequence regions


  • 5′ gaattctcagtcttcccactcatc 3′ (1)
  • 5′ ggcggccgcgaccatcaagttccagc 3′ (1)
  • acid (1)
  • across (2)
  • actin (132)
  • amino acids (3)
  • ammonium (2)
  • and viruses (1)
  • antibodies (15)
  • anti‐ antibodies (8)
  • anti‐ igg (1)
  • arp2 3 complex (5)
  • b 3 (1)
  • behavior (1)
  • bista (1)
  • blue (3)
  • bromophenol blue (1)
  • BSC (2)
  • case (3)
  • casein (1)
  • cb 10 (1)
  • Cdc42 (1)
  • cell plates (1)
  • cells number (1)
  • cellular (6)
  • cellular processes (2)
  • clathrin adaptor (2)
  • cold (1)
  • coronaviruses (2)
  • crystal violet (1)
  • CYA (179)
  • cytoplasm (1)
  • cytoskeleton (6)
  • cytoskeleton actin (1)
  • dapi (5)
  • data file (3)
  • dye (1)
  • e coli (1)
  • E2 protein (1)
  • electrophoresis (1)
  • elements (1)
  • embryo (1)
  • epithelium (1)
  • escherichia coli (1)
  • exocytosis (1)
  • f actin (8)
  • factors (2)
  • FHOD1 (1)
  • fibroblasts (1)
  • filaments (2)
  • filaments actin (1)
  • gene (2)
  • glycerol (3)
  • glycol acid (1)
  • gold (1)
  • Grb2 (1)
  • GST (23)
  • horseradish (1)
  • host cells (1)
  • human cells (3)
  • immunoblot (6)
  • impaired (1)
  • isoforms (46)
  • kinesin 1 (1)
  • lamellipodia (1)
  • listeria (2)
  • lung (1)
  • M protein (1)
  • mercaptoethanol (1)
  • methanol (2)
  • mgcl2 (1)
  • morpholino (1)
  • muscle (3)
  • N WASP (20)
  • nucleopolyhedrovirus (1)
  • n‐ actin (1)
  • orthopoxviruses (1)
  • parkinson (1)
  • pathogenesis (2)
  • penicillin (2)
  • period (1)
  • phalloidin (3)
  • phenotypes (3)
  • plasma membrane (3)
  • plasmids (7)
  • polyvinyl alcohol (1)
  • protein complexes (1)
  • proteins bacteria (1)
  • proteins bind (1)
  • ra proteins (1)
  • Rac1 (1)
  • rad (2)
  • reagent (1)
  • Rho GTPases (1)
  • sds page (2)
  • sequence homologies (1)
  • serum (5)
  • signal (2)
  • sirna (53)
  • skeletal muscle (1)
  • slide (1)
  • small gtpases (1)
  • smooth muscle (1)
  • sodium (1)
  • Src (6)
  • strains (8)
  • streptomycin (2)
  • stress fibres (3)
  • swine fever virus (2)
  • tetramethylethylenediamine (2)
  • trans golgi network (1)
  • tris (4)
  • triton (1)
  • tubulin (1)
  • tween 20 (1)
  • vaccinia (1)
  • vaccinia virus (101)
  • viral gene (1)
  • viral proteins (4)
  • virions (1)
  • virus particles (13)
  • western blots (1)
  • β actins (10)
  • γ actin (3)
  • Sizes of these terms reflect their relevance to your search.

    Actin is a major component of the cytoskeleton and is present as two isoforms in non-muscle cells: β- and γ-cytoplasmic actin. These isoforms are strikingly conserved, differing by only four N-terminal amino acids. During spread from infected cells, vaccinia virus (VACV) particles induce localized actin nucleation that propel virus to surrounding cells and facilitate cell-to-cell spread of infection. Here we show that virus-tipped actin comets are composed of β- and γ-actin. We employed isoform-specific siRNA knockdown to examine the role of the two isoforms in VACV-induced actin comets. Despite the high level of similarity between the actin isoforms, and their colocalization, VACV-induced actin nucleation was dependent exclusively on β-actin. Knockdown of β-actin led to a reduction in the release of virus from infected cells, a phenotype dependent on virus-induced Arp2/3 complex activity. We suggest that local concentrations of actin isoforms may regulate the activity of cellular actin nucleator complexes. © 2017 Wiley Periodicals, Inc.

    Citation

    N Bishara Marzook, Sharissa L Latham, Helena Lynn, Christopher Mckenzie, Christine Chaponnier, Georges E Grau, Timothy P Newsome. Divergent roles of β- and γ-actin isoforms during spread of vaccinia virus. Cytoskeleton (Hoboken, N.J.). 2017 Mar 17;74(4):170-183

    Expand section icon Mesh Tags

    Expand section icon Substances


    PMID: 28218453

    View Full Text