Correlation Engine 2.0
Clear Search sequence regions


  • 130a (142)
  • 3 utr (6)
  • 5’‐ accacagtccatgccatcac‐ 3’ (1)
  • 5’‐ aggactatcgtccgatcaac‐ 3’ (1)
  • 5’‐ cccttgggaacagcatgcta‐ 3’ (1)
  • 5’‐ ctggagaaactcccggtatc‐ 3’ (1)
  • 5’‐ gccctcacacctgcactgtgtc‐ 3’ (1)
  • 5’‐ gtgatacccgtggtagtacctc‐ 3’ (1)
  • 5’‐ gtgattcagccccatccgg‐ 3’ (1)
  • 5’‐ tcaccgcatgggttaaag‐ 3’ (1)
  • 5’‐ tcaccgccttggcttgtcacat‐ 3’ (1)
  • 5’‐ tcgaggcacacaaagaaga‐ 3’ (1)
  • 5’‐ tcttgaccctgacacccc‐ 3’ (1)
  • 5’‐ tgcacccacgacagaagggga‐ 3’ (1)
  • acid (4)
  • angiogenesis (13)
  • annexin v (1)
  • antigen (2)
  • apoptosis (14)
  • baculovirus (1)
  • Bcl‐ 2 (9)
  • BDNF (17)
  • biomaterials (1)
  • blood (1)
  • blood brain barrier (2)
  • blood flow (1)
  • blood vessels (3)
  • brain (48)
  • brain stem (1)
  • brdu (18)
  • bromide (1)
  • b‐ cell lymphoma (9)
  • C miR (1)
  • california (2)
  • cancers (2)
  • cases (7)
  • caspases (1)
  • CD31 (6)
  • cell death (2)
  • cells neural stem (10)
  • cells number (6)
  • cellular (4)
  • cerebellum (1)
  • china (3)
  • chloral (2)
  • cisplatin (2)
  • clamp (1)
  • conflict (2)
  • control group (7)
  • crystal (1)
  • cytoplasm (2)
  • d protein (1)
  • DCX (9)
  • dead (1)
  • decelerates (2)
  • deep anaesthesia (1)
  • digoxigenin (7)
  • diphenyl (1)
  • disease blood (1)
  • dry weight (3)
  • edta (1)
  • end (5)
  • eosin (5)
  • ethanol (2)
  • exert (2)
  • extracellular matrix (1)
  • factors (7)
  • firefly (1)
  • fitc (4)
  • flexion (1)
  • flow (4)
  • fluorescein (1)
  • forelimb (1)
  • g protein (1)
  • GAPDH (5)
  • gastric cancer (1)
  • gene (4)
  • HGF (11)
  • hypoxia (2)
  • IAP (2)
  • ice (1)
  • immunoglobulin g (1)
  • impairment (4)
  • improves (2)
  • inhibit (3)
  • ischaemia (10)
  • kind (1)
  • layer (2)
  • lithium (1)
  • mao (1)
  • MAP‐ 2 (3)
  • marrow (2)
  • micrornas (4)
  • microvessel (4)
  • MiR (152)
  • mir 130a target gene (1)
  • mrnas (1)
  • mtt (3)
  • neuron apoptosis (2)
  • neurons (50)
  • NGF (13)
  • nick (7)
  • nucleolus (2)
  • nucleotides (1)
  • number lesion (1)
  • oedema (2)
  • oligonucleotides (1)
  • ovarian cancer (2)
  • oxygen (43)
  • paraffin (1)
  • patients (2)
  • PBS 3 (1)
  • pcr (2)
  • penicillin (1)
  • phosphate (8)
  • plasmids (2)
  • protein levels (1)
  • protocol (2)
  • rats (74)
  • reagent (4)
  • regulates (1)
  • research (1)
  • resin (1)
  • rna (24)
  • rodent (1)
  • salt (1)
  • serum (6)
  • sham (23)
  • sign (1)
  • SMA 1 (1)
  • sodium (1)
  • stereopsis (1)
  • streptomycin (1)
  • stroke (24)
  • stromal cell (1)
  • target gene (4)
  • target protein (2)
  • thrombosis (2)
  • triphenyltetrazolium chloride (5)
  • tris (1)
  • tritc (3)
  • trypsin (1)
  • tween 20 (1)
  • VEGF (11)
  • vessels (5)
  • vital (2)
  • weight (2)
  • western blot (11)
  • XIAP (93)
  • xiap protein (5)
  • Sizes of these terms reflect their relevance to your search.

    MicroRNAs (miRNAs) have already been proposed to be implicated in the development of ischaemic stroke. We aim to investigate the role of miR-130a in the neurological deficit and angiogenesis in rats with ischaemic stroke by regulating X-linked inhibitor of apoptosis protein (XIAP). Middle cerebral artery occlusion (MCAO) models were established by suture-occluded method, and MCAO rats were then treated with miR-130a mimics/inhibitors or/and altered XIAP for detection of changes of rats' neurological function, nerve damage and angiogenesis in MCAO rats. The oxygen-glucose deprivation (OGD) cellular models were established and respectively treated to determine the roles of miR-130a and XIAP in neuronal viability and apoptosis. The expression levels of miR-130a and XIAP in brain tissues of MCAO rats and OGD-treated neurons were detected. The binding site between miR-130a and XIAP was verified by luciferase activity assay. MiR-130a was overexpressed while XIAP was down-regulated in MCAO rats and OGD-treated neurons. In animal models, suppressed miR-130a improved neurological function, alleviated nerve damage and increased new vessels in brain tissues of rats with MCAO. In cellular models, miR-130a inhibition promoted neuronal viability and suppressed apoptosis. Inhibited XIAP reversed the effect of inhibited miR-130a in both MCAO rats and OGD-treated neurons. XIAP was identified as a target of miR-130a. Our study reveals that miR-130a regulates neurological deficit and angiogenesis in rats with MCAO by targeting XIAP. © 2020 The Authors. Journal of Cellular and Molecular Medicine published by Foundation for Cellular and Molecular Medicine and John Wiley & Sons Ltd.

    Citation

    Wenjing Deng, Chenghe Fan, Yanan Zhao, Yuewei Mao, Jiajia Li, Yonggan Zhang, Junfang Teng. MicroRNA-130a regulates neurological deficit and angiogenesis in rats with ischaemic stroke by targeting XIAP. Journal of cellular and molecular medicine. 2020 Aug 13;24(18):10987-11000


    PMID: 32790238

    View Full Text