Correlation Engine 2.0
Clear Search sequence regions


  • 5′- aaacccgcgacgacttgctgtccc- 3′ (1)
  • 5′- aaacctacgagcccggggagaagc- 3′ (1)
  • 5′- aatcccgccttgtcactggg- 3′ (1)
  • 5′- caccgcttctccccgggctcgtag- 3′ (1)
  • 5′- caccgggacagcaagtcgtcgcgg- 3′ (1)
  • 5′- gcagtgactacacaacccgc -3 (1)
  • 5′- gctttggcatccccggaaaa- 3′ (1)
  • 5′- ggttccctgcggctcagatt- 3′ (1)
  • abt (3)
  • actin (26)
  • adult (1)
  • amino acid (2)
  • antibodies (1)
  • Aurora B (6)
  • blasticidin (1)
  • breast cancer (1)
  • bromophenol blue (1)
  • case (1)
  • Cdc2 (1)
  • cell cycle (2)
  • cell growth (6)
  • chicago (2)
  • chromatids (1)
  • constrict (2)
  • copies (1)
  • culture cells (1)
  • cytokinesis (18)
  • cytoskeleton (1)
  • Daam (1)
  • dapi (2)
  • denmark (2)
  • DIAPH1 (9)
  • DIAPH2 (11)
  • DIAPH3 (132)
  • diseases and (1)
  • dithiothreitol (1)
  • dna fragments (1)
  • dna library (1)
  • dna polymerase (1)
  • dna sequenced (1)
  • duplicates (1)
  • Ect 2 (2)
  • essential (5)
  • exon (2)
  • factor (9)
  • fiber (4)
  • filaments (3)
  • formins (9)
  • g2 phase (1)
  • GEF (1)
  • gene (23)
  • gene knockout (1)
  • giant cells (3)
  • glycerol (1)
  • heat (5)
  • heat shock protein 72 (8)
  • help (1)
  • homo (1)
  • HSP70 (1)
  • hyperthermia (1)
  • Inf2 (1)
  • isoform (1)
  • japan (9)
  • kinesin like protein (1)
  • lentivirus (2)
  • low (5)
  • meiosis (1)
  • mitosis (1)
  • MKLP2 (1)
  • mnng (2)
  • mobilizes (1)
  • myosin ii (3)
  • myosin- filaments (1)
  • normal growth (1)
  • nuclei cells (1)
  • number cells (3)
  • oligo (2)
  • oncogenesis (2)
  • oxygen (2)
  • paraformaldehyde (1)
  • pathogenesis (1)
  • pcr (1)
  • penicillin (1)
  • PGK (1)
  • phalloidin (2)
  • phenol red (2)
  • phenotypes (5)
  • plasmids (1)
  • protein level (1)
  • proteins genes (1)
  • pvdf (1)
  • random (2)
  • rapid (1)
  • regulates cytokinesis (2)
  • rho gtpases (4)
  • ring form (1)
  • sds page (1)
  • serum (2)
  • sex chromosome (1)
  • sign (1)
  • signal (3)
  • sirna (1)
  • sister (1)
  • slide (4)
  • sonic (1)
  • stop codon (1)
  • streptomycin (1)
  • target protein (1)
  • tokyo (4)
  • triton x- 100 (2)
  • western blot (1)
  • yeast (1)
  • α tubulin (5)
  • β tubulin (2)
  • Sizes of these terms reflect their relevance to your search.

    Cell division is essential for the maintenance of life and involves chromosome segregation and subsequent cytokinesis. The processes are tightly regulated at both the spatial and temporal level by various genes, and failures in this regulation are associated with oncogenesis. Here, we investigated the gene responsible for defects in cell division by using murine temperature-sensitive (ts) mutant strains, tsFT101 and tsFT50 cells. The ts mutants normally grow in a low temperature environment (32 °C) but fail to divide in a high temperature environment (39 °C). Exome sequencing and over-expression analyses identified Diaph3, a member of the formin family, as the cause of the temperature sensitivity observed in tsFT101 and tsFT50 cells. Interestingly, Diaph3 knockout cells showed abnormality in cytokinesis at 39 °C, and the phenotype was rescued by re-expression of Diaph3 WT, but not Diaph1 and Diaph2, other members of the formin family. Furthermore, Diaph3 knockout cells cultured at 39 °C showed a significant increase in the level of acetylated α-tubulin, an index of stabilized microtubules, and the level was reduced by Diaph3 expression. These results suggest that Diaph3 is required for cytokinesis only under high temperature conditions. Therefore, our study provides a new insight into the mechanisms by which regulatory factors of cell division function in a temperature-dependent manner.

    Citation

    Hiroki Kazama, Shu-Ichiro Kashiwaba, Sayaka Ishii, Keiko Yoshida, Yuta Yatsuo, Takuma Naraoka, Masashi Fukuoka, Yasufumi Murakami. Loss of DIAPH3, a Formin Family Protein, Leads to Cytokinetic Failure Only under High Temperature Conditions in Mouse FM3A Cells. International journal of molecular sciences. 2020 Nov 11;21(22)

    Expand section icon Mesh Tags

    Expand section icon Substances


    PMID: 33187357

    View Full Text