Sign in Register Copyright © 2026 Illumina Inc. All Rights Reserved
Build:
Version: 2.8.0.
Clear Search sequence regions


Sizes of these terms reflect their relevance to your search.

To explore the genetic basis for three children patients with CHARGE syndrome. The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Citation

Zhiyan Tao, Fang Lu. Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome]. Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics. 2021 Jan 10;38(1):42-46

Expand section icon Mesh Tags

Expand section icon Substances


PMID: 33423256

View Full Text