Correlation Engine 2.0
Clear Search sequence regions


  • 4 and (1)
  • 5’- ctaggccacagaattgaaagatct− 3′ (1)
  • 5′- agggacacagcattggagtc− 3′ (1)
  • 5′- agggtcccatgttctgagc− 3′ (1)
  • 5′- gtaggtggaaattctagcatcatcc− 3′ (1)
  • 5′- gtgtggacaccccacataca− 3′ (1)
  • acid (2)
  • adenoma (1)
  • adult (3)
  • allele (17)
  • amino acid (2)
  • androgen receptor (2)
  • anti- igg (3)
  • antibodies (5)
  • antigen (2)
  • apoptosis (2)
  • berlin (1)
  • birth (1)
  • blood testis- barrier (1)
  • blue (2)
  • brain (44)
  • BRCA1 (47)
  • case (1)
  • Cdc25 (3)
  • cdna (7)
  • cell cycle (2)
  • cell numbers (5)
  • cellular (7)
  • Chk1 (4)
  • chromatin (1)
  • cold (6)
  • condensin 13 (1)
  • condensin ii (1)
  • Ctip (2)
  • Ctip2 (4)
  • d protein (1)
  • dapi (8)
  • Ddx4 (6)
  • DIA (1)
  • dish (2)
  • dna damage (14)
  • dna repair (5)
  • domain protein (2)
  • element (1)
  • embryos (4)
  • eosin (3)
  • epithelium (5)
  • essential (3)
  • exons (30)
  • flow (1)
  • forebrain (2)
  • formic acid (4)
  • gap junction protein (1)
  • gene (9)
  • genotypes (4)
  • germ cells (7)
  • gold (1)
  • gonad (9)
  • granulosa cell (1)
  • heart (1)
  • hematoxylin (4)
  • hepes (2)
  • human (10)
  • human cells (2)
  • human chromosome (1)
  • ice (1)
  • igg (1)
  • impaired (4)
  • insA (3)
  • intron (2)
  • isoforms (2)
  • knockout mice (2)
  • layer (3)
  • leydig cells (2)
  • Lin28 (11)
  • live birth (1)
  • liver (2)
  • m checkpoint (1)
  • manner (1)
  • mayer hemalum (1)
  • MCPH1 (229)
  • MCPH1 protein (13)
  • MEFs (6)
  • meiosis (2)
  • methanol (1)
  • mitosis (1)
  • mutant protein (1)
  • neocortex (10)
  • neomycin (3)
  • neurogenesis (1)
  • neurons (2)
  • newborn (3)
  • OMIM251200 (3)
  • ovarian cancer (1)
  • ovarian follicles (1)
  • ovaries (17)
  • ovaries small (1)
  • ovary mass (1)
  • ovary tumours (9)
  • paraffin (4)
  • parallel (9)
  • patient (9)
  • PBS (13)
  • penicillin (1)
  • Pep1 (3)
  • Pep2 (3)
  • Pep3 (3)
  • peptides (17)
  • period (3)
  • phenotypes (4)
  • phenotypes n (1)
  • pregnant (2)
  • present testes (1)
  • promega (3)
  • protocol (2)
  • pvdf (1)
  • SacI (3)
  • sertoli- cell (8)
  • serum (3)
  • signals (1)
  • SNF (1)
  • sodium (3)
  • solutions (1)
  • solvent (4)
  • southern blot (5)
  • Sox2 (5)
  • Sox9 (6)
  • Sox9 (1)
  • spermatogonial stem cells (10)
  • spermatozoa (1)
  • sperms (1)
  • stem cells (2)
  • steroid (1)
  • streptomycin (1)
  • student (5)
  • suggests (4)
  • SWI (1)
  • synapsis (1)
  • Tbr2 (4)
  • testicular tumours (1)
  • testis (21)
  • thymus (1)
  • TopBP1 (1)
  • triton x- 100 (2)
  • trypsin (1)
  • tubular adenoma (1)
  • tumour (5)
  • tween 20 (2)
  • weight (8)
  • β actin (2)
  • Sizes of these terms reflect their relevance to your search.

    MCPH1 is a causal gene for the neurodevelopmental disorder, human primary microcephaly (MCPH1, OMIM251200). Most pathogenic mutations are located in the N-terminal region of the gene, which encodes a BRCT domain, suggesting an important function of this domain in brain size determination. To investigate the specific function of the N-terminal BRCT domain in vivo, we generated a mouse model lacking the N'-BRCT domain of MCPH1 (referred as Mcph1-ΔBR1). These mutant mice are viable, but exhibit reduced brain size, with a thinner cortex due to a reduction of neuroprogenitor populations and premature neurogenic differentiation. Mcph1-ΔBR1 mice (both male and female) are infertile; however, almost all female mutants develop ovary tumours. Mcph1-ΔBR1 MEF cells exhibit a defect in DNA damage response and DNA repair, and show the premature chromosome condensation (PCC) phenotype, a hallmark of MCPH1 patient cells and also Mcph1 knockout cells. In comparison with Mcph1 complete knockout mice, Mcph1-ΔBR1 mice faithfully reproduce all phenotypes, indicating an essential role of the N-terminal BRCT domain for the physiological function of MCPH1 in the control of brain size and gonad development as well as in multiple cellular processes.

    Citation

    Xiaoqian Liu, Nadine Schneble-Löhnert, Martina Kristofova, Xiaobing Qing, Jan Labisch, Susanne Hofmann, Sandra Ehrenberg, Mara Sannai, Tjard Jörß, Alessandro Ori, Maren Godmann, Zhao-Qi Wang. The N-terminal BRCT domain determines MCPH1 function in brain development and fertility. Cell death & disease. 2021 Feb 01;12(2):143


    PMID: 33542216

    View Full Text