Clear Search sequence regions


  • 5′‐ cacaagcttgaaagatgaagattcttctagc‐ 3′ (1)
  • 5′‐ cacgaatgggagaagtttggtacttgctctgaatcg‐ 3′ (1)
  • 5′‐ cgactgcagaactaaaaagaagggaattcgatctcagc‐ 3′ (1)
  • 5′‐ gctgattttggcattttcggtctttggcctaac‐ 3′ (1)
  • actin (2)
  • AGO1 (1)
  • agrobacterium tumefaciens (1)
  • al 1 (1)
  • amino acid (3)
  • ammonium (1)
  • ANNEXIN 1 (1)
  • apoplast (2)
  • apoptosis (1)
  • arabidopsis (35)
  • arabidopsis proteins (2)
  • arabidopsis thaliana (1)
  • aspergillus (1)
  • atp (74)
  • atp receptors (3)
  • AtRNS1 (1)
  • biosynthesis (3)
  • blue (6)
  • bromophenol blue (1)
  • Ca2 (5)
  • calcium (2)
  • calcium channels (1)
  • cat (1)
  • cdna (2)
  • cell death (78)
  • cell wall (1)
  • cellular (1)
  • colicin e3 (1)
  • cultures cell (1)
  • cy5 (2)
  • cyclic (1)
  • cytoplasm (1)
  • cytosol (1)
  • cytotoxins (1)
  • data file (1)
  • death rates (1)
  • digest (1)
  • direct (1)
  • dna fragment (1)
  • dye (2)
  • EGFP (1)
  • EIF4A (1)
  • electrophoresis (1)
  • essential (4)
  • extracts plants (4)
  • flower (1)
  • forceps (4)
  • fractions cell (1)
  • fumonisin b1 (108)
  • function (15)
  • fusarium (1)
  • g Protein (1)
  • gel electrophoresis 2d (1)
  • gene (28)
  • gene expressed (1)
  • gene knockout (4)
  • gene networks (1)
  • gene plant (1)
  • gene processes (1)
  • genes function (1)
  • genes proteins (2)
  • genotypes (2)
  • glycerol (1)
  • hplc (2)
  • hydrolases (1)
  • inhibits (1)
  • intracellular proteins (2)
  • ion channel (3)
  • isopropanol (1)
  • leaves plants (5)
  • lectin (1)
  • maldi (1)
  • maldi ms (1)
  • methanol (1)
  • minor (2)
  • molecular weight (3)
  • mutagenesis (1)
  • mycotoxin (5)
  • native (19)
  • nitric oxide (1)
  • nucleotides (7)
  • oxygen (2)
  • P450 (1)
  • pcr (3)
  • peptides (1)
  • peptides c (1)
  • period (3)
  • photoperiod (2)
  • plant (12)
  • plants cell (1)
  • plants leaf (1)
  • plasma membrane (4)
  • plasmid (12)
  • PLCL1 (14)
  • pollen (5)
  • pollen tube (3)
  • pRCS2 (2)
  • processes (6)
  • protein b (2)
  • protein c (1)
  • protein control (1)
  • protein levels (2)
  • protein plants (2)
  • protein targets (1)
  • PstI (1)
  • rana pipiens (1)
  • rapid (3)
  • receptor complex (1)
  • receptors (5)
  • receptors bind (1)
  • regulates (2)
  • regulates responses stress (1)
  • research (1)
  • respond (8)
  • rice (1)
  • RNase (18)
  • RNS1 (203)
  • RNS2 (2)
  • RNS3 (3)
  • RNS4 (2)
  • salicylic acid (23)
  • salt (1)
  • screen (6)
  • shut (1)
  • signal (4)
  • sodium (9)
  • solutions (3)
  • sphingolipid (3)
  • stress‐ proteins (2)
  • student (1)
  • subunits (3)
  • suggest (2)
  • suppress (3)
  • t dna (7)
  • target protein (1)
  • time reaction (1)
  • tobacco (2)
  • torulopsis utilis (1)
  • tris (9)
  • trna (4)
  • tumour (1)
  • understand (2)
  • α sarcin (1)
  • Sizes of these terms reflect their relevance to your search.

    Extracellular ATP is a purinergic signal with important functions in regulating plant growth and stress-adaptive responses, including programmed cell death. While signalling events proximate to receptor activation at the plasma membrane have been characterised, downstream protein targets and the mechanism of cell death activation/regulation are unknown. We designed a proteomic screen to identify ATP-responsive proteins in Arabidopsis cell cultures exposed to mycotoxin stress via fumonisin B1 (FB1) application. Arabidopsis RIBONUCLEASE 1 (RNS1) was identified by the screen, and transgenic plants overexpressing native RNS1 showed greater susceptibility to FB1, while a gene knockout rns1 mutant and antisense RNS1 transgenic plants were resistant to FB1-induced cell death. Native RNS1 complemented rns1 mutants and restored the cell death response to FB1, while a catalytically inactive version of the ribonuclease could not. The FB1 resistance of salicylic acid (SA)-depleted nahG-expressing plants was abolished by transformation with native RNS1, but not the catalytically dead version. The mechanism of FB1-induced cell death is activation of RNS1-dependent RNA cleavage, which is blocked by ATP via RNS1 suppression, or enhanced by SA through induction of RNS1 expression. Our study reveals RNS1 as a previously unknown convergence point of ATP and SA signalling in the regulation of stress-induced cell death. © 2022 The Authors. New Phytologist © 2022 New Phytologist Foundation.

    Citation

    Heather L Goodman, Johan T M Kroon, Daniel F A Tomé, John M U Hamilton, Ali O Alqarni, Stephen Chivasa. Extracellular ATP targets Arabidopsis RIBONUCLEASE 1 to suppress mycotoxin stress-induced cell death. The New phytologist. 2022 May 31;235(4):1531-1542

    Expand section icon Mesh Tags

    Expand section icon Substances


    PMID: 35524456

    View Full Text