Zilong Wang, Yakun Fang, Yi Shi, Yu Xin, ZhengHua Gu, Ting Yang, Youran Li, Zhongyang Ding, Guiyang Shi, Liang Zhang
International journal of molecular sciences 2022 Apr 30With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.
Zilong Wang, Yakun Fang, Yi Shi, Yu Xin, ZhengHua Gu, Ting Yang, Youran Li, Zhongyang Ding, Guiyang Shi, Liang Zhang. Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression. International journal of molecular sciences. 2022 Apr 30;23(9)
Mesh Tags
Substances
PMID: 35563415
View Full Text